x86-64 Pipeline used to trim and combine sanger raw data to retrieve a consesus read and other results

Citations

1. Tsiouri, O. (2024). Sanger analysis pipeline: An x86-64 Pipeline used to trim and combine sanger raw data to retrieve a consesus read and other results v2.0. https://github.com/olgatsiouri1996/sanger_analysis_pipeline
2. Kuan-Hao Chao, Kirston Barton, Sarah Palmer, and Robert Lanfear (2021). "sangeranalyseR: simple and interactive processing of Sanger sequencing data in R" in Genome Biology and Evolution. DOI: doi.org/10.1093/gbe/evab028

Installation

1. Install Docker
2. Install the following containers on your machine:

docker pull olgatsiouri/sanger_analysis:latest

docker pull olgatsiouri/python-pandas:latest

Usage

The data used were derived from the sangeranalyseR and can be found on input_data.zip

In order to add the sangeranalyseR parameters to be used for trimming and alignment of reads a parameters.txt tab seperated file is used.

Νotes

1. You can open parameters.txt on excel to make modifications
2. Do not change the filename parameters.txt
3. Do not change the parameters: printLevel, inputSource, processMethod, ABIF_Directory, FASTA_File, CSV_NamesConversion and geneticCode
4. parameters.txt should be in the same folder as the raw .ab1 files

In order to run the container type the following in ubuntu or intel mac machines:

docker run --rm -v /path/to/ab1/folder:/ab1 -v /path/to/save/report:/report -v /path/to/save/fasta:/fasta olgatsiouri/sanger_analysis  

on mac silicon:

docker run --rm --platform=linux/amd64 -v /path/to/ab1/folder:/ab1 -v /path/to/save/report:/report -v /path/to/save/fasta:/fasta olgatsiouri/sanger_analysis  

or on windows machines:

docker run --rm -v C:\path\to\ab1\folder:/ab1 -v C:\path\to\save\report:/report -v C:\path\to\save\fasta:/fasta olgatsiouri/sanger_analysis  

This command:

1. Imports the .ab1 and parameters.txt in the container
2. Selects in which folder to generate a report containing the consesus sequence and other data
3. Selects in which folder to save the trimmed reads and their alignment in fasta format

If you want to retrieve the consesus sequence in fasta format do the following:

1. Navigate to the folder you have save the report and open the SangerAlignment folder
2. open SangerAlignment_Report.html
3. Go to Contigs Consensus and click MORE DETAILS

4. Click on the top left diagonal box to select the whole consesus sequence

5. right click on 1 to the right of the diagonial box
6. click save as

7. This will Download a jexcel.csv file that you can use to convert to fasta
8. download the consesus_csv_to_fasta.py from the src/ folder
9. put the script and jexcel.csv at the same directory
10. run docker

on linux/mac os x64-86:

docker run --rm -it -v /path/to/folder:/data python-pandas /data/consesus_csv_to_fasta.py <input_csv> <fasta_width> <output_fasta>

on mac silicon:

docker run --platform=linux/amd64 --rm -it -v /path/to/folder:/data python-pandas /data/consesus_csv_to_fasta.py <input_csv> <fasta_width> <output_fasta>

or on windows:

docker run --rm -it -v C:\path\to\folder:/data python-pandas /data/consesus_csv_to_fasta.py <input_csv> <fasta_width> <output_fasta>

example:

docker run --rm -it -v /home/linuxubuntu2004/Desktop:/data python-pandas /data/consesus_csv_to_fasta.py jexcel.csv 80 drosho_consesus.fasta

The output fasta file will look like:

>consesus_seq
TTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTTGGAACATCTTTAAGAATTTTAATT
CGAGCTGAATTAGGACATCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATT
GTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGA
TTTGGAAATTGATTAGTGCCTTTAATATTAGGTGCTCCTGATATAGCATTCCCACGAATA
AATAATATAAGATTTTGACTTCTACCTCCTGCTCTTTCTTTACTATTAGTAAGTAGAATA
GTTGAAAATGGAGCTGGGACAGGATGAACATGTTTATCCACCTCTATCCGAGCTGGAATT
GCTCATGGTGGAGCTTCAGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCT
TCAATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATT
TCATTAGATCGTATACCTTTATTTGTTTGATCAGTAGTTATTACTGCTTTATTATTATTA
TTATCACTTCCAGTACTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAAT
ACATCATTTTTTGACCCAGCGGGAGGAGGAGATCCTATTTTATACCAACATTTATT